Team:SCAU-China/Methods & Materials

MEDIUM

•LB medium

• Tryptone 10 g/L
• Yeast Extract 5 g/L
• NaCl 10 g/L

•SOC medium

• Tryptone 20 g/L
• Yeast Extract 5 g/L
• NaCl 0.50 g/L
• KCl 0.18 g/L
• MgCl 0.59 g/L
• Glucose 3.6 g/L

MFC performance assay

1.Prepare anode medium, cathode medium and MFC device, autoclave at 115℃ for 15 min.
2.Inoculate E.coli at 37℃ overnight until optical density (OD600nm) reach 2.0
3.Centrifuge at 25℃, 5000 rcf, 5 min discard supernatant and resuspend bacteria with 100 mL anode medium solution.
4.Fill the anode chamber with anode solution and seal with rubber plug. Pour 60~80 mL cathode medium into cathode chamber until the proton exchanging membrane (PEM) being overwhelm.
5.Load a 1,000 Ω resistor into the circuit, and connect to the digital multimeter with recorder.
6.Incubate the chamber overnight at 37℃.

Medium for MFC

•Anode medium

Ingredient	Concentration
glucose	2.0 g/L
NH4Cl	0.25 g/L
KCl	0.1 g/L
trace element solution	10 mL
PBS buffer (Na2HPO4 and NaH2PO4)	50 mM
riboflavin	100 μM

•Trace element stock solution

Ingredient	Concentration (g/L)
MgSO4•7H2O	3.0
MnSO4•H2O	0.5
NaCl	1.0
FeSO4•7H2O	0.1
CoCl2•6H2O	0.1
CaCl2	0.1
ZnSO4•7H2O	0.1
CuSO4•5H2O	0.01
KAl(SO4)2•12H2O	0.01
H3BO3	0.01
Na2MoO4•2H2O	0.01

•Cathode solution
50mM PBS

Constructs through Ω-PCR

1.design primers containing overlap sequences.
2.1st Ω-PCR
3.Exo I digest at 37 ℃ for 20 min.
4.2nd Ω-PCR
5.Dpn I digest at 37 ℃ for 1 hour.
6.Dialysis for 30min
7.Transform into electrocomponent cells

•1st Ω-PCR mixture

	For 1 reaction	Final concentration
2x PCR buffer for KOD FX	10 μl	1 ×
2mM dNTPs	4 μl	0.4 mM each
10μM Primer #1	0.4	0.2 μM
10μM Primer #2	0.4	0.2 μM
		Genomic DNA ~200 ng / 50μl
Template DNA	≧ 1 μl	Plasmid DNA ~50 ng / 50μl cDNA (from ~200 ng RNA) / 50μl
KOD FX (1.0U/μl)	0.4 μl	1.0 U / 50 μl
Autoclaved, distilled water	up to 20 μl

PCR cycle condition

Step	Temp	Time
1:Predenature	94 °C	4 min
2:Denature	98 °C	15 s
3:Annealing	（Tm-5）°C	30 s
4:Extension	68 °C	1min/kb DNA
5:Go To step 2	/	35 cycles
6:Final Extension	68 °C	10 min
7:Storage	4 °C	∞

•2nd Ω-PCR mixture

	For 1 reaction	Final concentration
2 x PCR buffer for KOD FX	10 μl	1×
2mM dNTPs	4 μl	0.4 mM each
1st Ω-PCR product	≥1 μl	50~400 ng
Template plasmid	≥ 1 μl	5~100 ng
KOD FX (1.0 U/μl)	0.4 μl	1.0 U / 50 μl
Autoclaved, distilled water	up to 20 μl

PCR cycle conditions

Arca knockout method

1. Transfer plasmid pKD46 into the wild type E. coli MG1655; screen the positive colony using Ampicillin.
2. Use pKD46 specific primers to screen transformants by colony PCR.
3. Prepare pKD46 positive electrocomponent cell.
4. Amplify Kanamycin resistant gene NPTII using primer 1 and 2.
5. Purify the NPTII fragment by electrophoresis.
6. Transfer the NPTII segment into the wild type cell with pKD46.
7. Screen Kan and Amp resistant strain on selection media.
8. Use PCR (primer 3 and 4) to confirm the arcA knock-out colony.
9. Sequencing the target gene to confirm the knock-out effect.

Primer 1 gacttttgtacttcctgtttcgatttagttggcaatttaggtagcaaacatgagccatattcaacggga
Primer 2 ataaaaacggcgctaaaaagcgccgttttttttgacggtggtaaagccgattagaaaaactcatcgagca
Primer 3 gtcatgttacgccgatcatg
Primer 4 ttgggaaccagtgtgctggt


Confirming PCR reaction mixture

Component	Volume (μl)
ddH2O	13
10 x PCR buffer	2
dNTP mix	0.4
Primer 3	0.4
Primer 4	0.4
Taq polymerase	0.4
Bacteria	3

Amplification PCR reaction mixture

Component	Volume (μl)
ddH2O	160
10 x PCR buffer	20
dNTP mix	4
Primer 3	4
Primer 4	4
Taq polymerase	4
DNA template	4